Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14392B4
Clone ID IST14392B4
Vector VICTR74
Project tigm

Sequence tag IST14392B4BBF2
Sequence
GCAGATCTGTCGAGGTCGATCGACGGTATCGATTANTCCAATTTANNNANNATCCNGCCCTCTTCTCTTTGCCTCCCCCA
CACTGNNNNNATACAATGTGCCNTCNNGCCCANTTTCAGCNNGGATGCTGGGAATCTGAACCCNGGTCCTGATGCNGTGT
GNCAAGCACTTTATCANCNNNNCTACNTTCCNNACTTTGGCTTAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14392B4HMF1
Sequence
GCAGATCTTGAGACTTCTCCACGTCTATAAAACAGAATTCTTACTCCTTGCTATAAGAAAATAATATAATAATAATACAG
CCAGCAGATCTTGAGACTTCTCCATGTCTATAAAACAGAATTCTTACTCCTTGCTATAAGAACATGCCCTCCGAGGAGAA
GCACACTGAAACTGCACAGAGGTCTCACCAGGATACAGGACTATTCACGGCAAGGGGGGGCCCAAGGCTCTAGGTGTGCA
CAGTATTGGAAATGTCCCACAGACCTCCTGTCAATGGACAATGCCCCCACCCCCACCCCATGCTCCTCATCAAGCCTCAA
ACTGTTCAAAAAAGTCAATGGCCAG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 106570117..106570460 344
 
EST/CDNA Est Name
  CJ078981.1 - CN680180.1 - CR759542.1 - CN665664.1 - AA717681.1 - CA481934.1 - BE376518.1 - BY768107.1 - BY228361.1 - BY277502.1 - BY228435.1 - BY343374.1 - BY143696.1 - CJ186145.1 - BY339438.1 - BY137938.1 - BY777343.1 - BY147343.1 - BY146921.1 - BY790997


Sequence tag IST14392B4HMR1
Sequence
TGCTGGCTGTATTATTTTCCTGTTTGCTTGATTTTGCAAAATCAAAGACCAAAGAACAGGACTGGGGATATGCCTCAGAG
TTCATCTGGCATGTGTGGCTCCCTGGTTTTGATCCCTAAAGCCACACATGGTGGTACAAGCCTATAACACTAGGACTTGG
GANATAGAGACANGAAAACCATAAAGTTCAAAATCCTACCTAATCCTTGGCTACATANTGGGTTCATGGCN
Sequence Type genomic DNA
Unitrap ID UNI10799

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 106569890..106570119 224
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020717 (Pecam1) NM_008816 platelet/endothelial cell adhesion molecule 1 Gene [Source:MGI (curated);Acc:Pecam1-002]

 
Come back to gene ENSMUSG00000020717


For any suggestions or comments, please send an email to unitrap@crg.es