Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST467407
Clone ID OST467407
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST467407
Sequence
CTGGGCCGAAGGATCAAGTGCCCTGNGNCGAGGACGGGGACANGTATGCCCAGCTCCTAGTGGAGACAGATACCATTNGG
GAGTCANGNCCGGATCANGGGCAAGGAGACAGAATNCTACCTGTGTATGAACCGAANNGGCAAGCTCGTNNGGAANCCTG
ATGGTACTAGCAAGGAGTGC
Sequence Type mRNA
Unitrap ID UNI16040

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 33018008..33034248 86
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000057967 (Fgf18) NM_008005 fibroblast growth factor 18 Gene [Source:MGI (curated);Acc:Fgf18-001]

 
Come back to gene ENSMUSG00000057967


For any suggestions or comments, please send an email to unitrap@crg.es