Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15089D5
Clone ID IST15089D5
Vector VICTR80
Project tigm

Sequence tag IST15089D5HMF2
Sequence
CAATAACAAGGTTGTAAATACGCCTAACATGATATAACTATCCCTCGTACAATCGCAAACGCATTAGTAAATTTACAATG
GGCATTCATATTACTTTATAATCCTCGTTTCTGCAACTGGTTACGTGGCCTTAATTGGTATTTATAACTACCTTCCTCTA
CTACCCATTCTGTATTTCCTTCACCTTCAGCCAGCACCTCAGCAGGTCTTGGCTCTTTTCCTGGAGGATTGACCCATACC
TTCATTCCTGATGGGTCTGCGTCCTTTGTCATCCTGCTTGGATTAGGCTGTTGTANTTTCCCATTGACTTTAATCACAGG
ACATGGTAGTACTAANAGACGCCCTAAGGGATCTCCTGCACTCCANACATAATCTTGCTNACNACCATTGTGAAGAGGTA
ATCCAATTTCCCCATGGTAATCTGGATCTATCACCCCTCCTANNACTGNTATTCCTTTTTNANCCTGTTGGTTTAN
Sequence Type genomic DNA
Unitrap ID UNI9273 UNI30945 UNI30946 UNI34136

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 19945460..19945934 455
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 4658592..4659066 455
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033960 (9430020K01Rik) NM_001081963 RIKEN cDNA 9430020K01 gene Gene [Source:MGI Symbol;Acc:MGI:2685174]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 37576363..37576837 455
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 31819393..31819867 455
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022770 (Dlg1) NM_007862 discs, large homolog 1 (Drosophila) Gene [Source:MGI (curated);Acc:Dlg1-002]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 16879082..16879556 455
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 50076820..50077294 455
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 9510890..9511364 455
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 22295968..22296442 455
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 20424174..20424648 455
 
EST/CDNA Est Name
  BU563801.1 - AV206190.2
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 14976657..14977131 455
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 10938747..10939221 455
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 15692565..15693039 455
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 16986100..16986574 455
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 30447333..30447807 455
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 32977315..32977789 455
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000014932 (Yes1) NM_009535 Yamaguchi sarcoma viral (v-yes) oncogene homolog 1 Gene [Source:MGI Symbol;Acc:MGI:99147]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 39595047..39595521 455
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 82087829..82088303 455
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 17880223..17880697 455
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 10099345..10099819 455
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025780 (Itih5) NM_172471 inter-alpha (globulin) inhibitor H5 Gene [Source:MGI (curated);Acc:Itih5-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 16612561..16613035 455
NO GENE  


Sequence tag IST15089D5BBF1
Sequence
ANTAACAAGGTTGTAAATACGCCTAACATGATATAACTATCCCTCGTACAATCGCAAACGCATTAGTAAATTTACAATGG
GCATTCATATTACTTTATAATCCTCGTTTCTGCAACTGGTTACGTGGCCTTAATTGGTATTTATAACTACCTTCCTCTAC
TACCCATTCTGTATTTCCTTCACCTTCAGCCAGCACCTCAGCAGGTCTTGGCTCTTTTCCTGGAGGATTGACCCATACCT
TCATTCCTGATGGGTCTGCGTCCTTTGTCATCCTGCTTGGATTAGGCTGTTGTAGTTTCCCATTGACTTTAATCACAGGA
CATGGTAGTACTAAGAGACGCCCTAAGGGATCTCCTGCACTCCAGACATAATCTTGCTTACCACCATTGTGAAGAGGTAA
TCCAATTTCCCCATGGTAATCTGGATCTATCACCCCTCCTAACACTGTTATTCCTTTTTNANCCTGTTGGTTTAN
Sequence Type genomic DNA
Unitrap ID UNI2778 UNI10954

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 40100228..40100699 468
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 3058704..3059175 468
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 8529488..8529959 468
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 11338826..11339297 468
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 84582382..84582853 468
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 35143735..35144206 468
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 37796707..37797178 468
 
EST/CDNA Est Name
  BB696514.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 7981906..7982377 468
 
EST/CDNA Est Name
  AA647416.1 - BU512518.1 - AA547133.1 - AA591850.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 30503319..30503790 468
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 65129009..65129480 468
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 46793429..46793900 468
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 89208275..89208746 468
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 64879381..64879852 468
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 5177837..5178308 468
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 20334822..20335293 468
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039987 (Phtf2) NP_766580 putative homeodomain transcription factor 2 Gene [Source:MGI (curated);Acc:Phtf2-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 3306513..3306984 468
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 35611370..35611841 468
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 19616469..19616940 468
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 142620310..142620781 468
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038844 (Kif16b) NM_001081133 kinesin family member 16B Gene [Source:MGI (curated);Acc:Kif16b-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 34140582..34141053 468
NO GENE  

 
Come back to gene ENSMUSG00000038844


For any suggestions or comments, please send an email to unitrap@crg.es