Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13003B6
Clone ID IST13003B6
Vector VICTR76
Project tigm

Sequence tag IST13003B6BBF1
Sequence
GGATAACATTTTCTTGAGGAAACCTATTTAATTTTGTGGGTTAGGTTTTTAAAATATCAGTATTAAGGAAGGGGTTCTGA
TACTAATTTGTTGAAANANTAAAATTATTTGTAAATACTTGGAATTAANAANGTACTTCTTAAATNTNAATANNNCNNCN
NTTTN
Sequence Type genomic DNA
Unitrap ID UNI35599

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 44933292..44933443 140
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035649 (Zcchc7) NM_177027 zinc finger, CCHC domain containing 7 Gene [Source:MGI (curated);Acc:Zcchc7-003]

 
Come back to gene ENSMUSG00000035649


For any suggestions or comments, please send an email to unitrap@crg.es