Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14557A8
Clone ID IST14557A8
Vector VICTR74
Project tigm

Sequence tag IST14557A8HMF1
Sequence
CTCACAACTTCCTAGTGCCTCCTGTTAGGTCTACTTATCAGCAGAGATGTAAACGATATCACTTTTCACCCTTAGCAGTG
AATTTCTTCACTTTTTTACTGCTTTCTGTCCCAACTTTAATGTTCTTTTAATGTAGTTTTTCCTGTGTGATATATCATAT
TTATCTCCATAGCAATCCATCACTATTTCCTTTAATTGAGGTTAATTTCTTTCAACTTGGGCGAGGATGGGAGGGCTGAG
GGGCTCTCGGTGTGCTGCTCANAGCGTGGAGGGCATTCACAGCTGCTTCACGGAGCTTGATTTTCAGGANGCNNGAATTC
CTCAAGCCCACCCNACTGCCCTCCAATCTGGACCTAANTCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 84226385..84226744 348
 
EST/CDNA Est Name
  BY151951.1 - BY029464.1 - BF721729.1


Sequence tag IST14557A8HMR1
Sequence
GTGAGCATGCTCTGATTTGGAAGGAGGAGGGCTCAGTAGACAGTTTCATTGCCTGGATTTAAGCAGAGCTCATCTCTGAN
TGATCATAGCCCATGGAGGAAAAGCTGTTCCTTTAACTAGAAGACTTAGGGGTTTTAGAGTTTGGCTGTGGAGGGCCAGG
TTGTAATTCTGCACCACAGCTTTTCAATACCTGANACCTTANCTTTAGTGTCACATAAGTCAAGGACTCCTTCTGAAAGG
CTTGGTTTAATTTGTGCATTTTANACATTGATTAACAAGTAAATAATTTAATANCAGGTTTAATGATATTANTGCCNTTG
TGACTTCTGAATAAAAAAATTTANATTGNATTCANTTCATAAGTGGGGTTTTGAATATTTGGGGAAAATTANGGTTGNNT
GNTANAA
Sequence Type genomic DNA
Unitrap ID UNI1445

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 84225986..84226389 376
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028487 (Bnc2) NM_172870 basonuclin 2 Gene [Source:MGI (curated);Acc:Bnc2-001]

 
Come back to gene ENSMUSG00000028487


For any suggestions or comments, please send an email to unitrap@crg.es