Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10357E5
Clone ID IST10357E5
Vector VICTR76
Project tigm

Sequence tag IST10357E5BBF1
Sequence
AGGACCAGGAGACAAAATGGCATCCCANNTGCACACATNAATAAGTTCTGGAGGTAAAAAGCAACCANTCAATGTATTTA
TTCTTGCTATGTGCCTGGTGTGATTGGGGACCGTGGTGGCTTTAGGGGTAAGGGAGAAAGCTGCATGAAGTCAGAGTGGG
TCACCTTCAGTGAACTGCATCAGCTTCTCATGGTTAANACAGTTAACCCAGCTACTGTCATGATGGAGGACAGAAGGAGC
TGAGCACTGTGGGAATCTGCTANCTTTTCTCTTCNNCCTNCTGCCNTCCTCCTGCTTTATGATAAGACAGGGTCATGGGG
GCTCTCTNANTGTGCTCTTCATTGGAATTGATTANAACTAGCNAGCTTGACTGCATATGGAANGTGCTGAAAACAATCNN
CTTCAATGTGATAAAAGGTTCTGNNCTNTGAAAATGAGACAGANAAGANGGAGAANNAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST10357E5HMF1
Sequence
AGGACCAGGAGACAAAATGGCATCCCAGATGCACACATCAATAAGTTCTGGAGGTAAAAAGCAACCAGTCAATGTATTTA
TTCTTGCTATGTGCCTGGTGTGATTGGGGACCGTGGTGGCTTTAGGGGTAAGGGAGAAAGCTGCATGAAGTCAGAGTGGG
TCACCTTCAGTGAACTGCATCAGCTTCTCATGGTTAAGACAGTTAACG
Sequence Type genomic DNA
Unitrap ID UNI23070

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 93008198..93008404 207
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036168 (Ccdc38) NM_175488 coiled-coil domain containing 38 Gene [Source:MGI (curated);Acc:Ccdc38-001]

 
Come back to gene ENSMUSG00000036168


For any suggestions or comments, please send an email to unitrap@crg.es