Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10731E9
Clone ID IST10731E9
Vector VICTR76
Project tigm

Sequence tag IST10731E9HMF1
Sequence
CCCCGACATTGAGACAACTGAGGCAAGTGAACTGTGAGTTCTAGACTAGCCTGGGCTGCAAAGCTGGTCCCTGTAACAAA
AACAAACAAATAAATAAAATCACAATTGCACGTTGGCAATCTAAGAGCTACTGACCGCTTCAGTGTCTCTCGCATCTATA
ATTACGTTGTCTCTGACATGTTTTAGTTTGTAAATCTCTACAGTACAAAATTCCACGGCAAACTTGGCCTCCACAATGTT
NNNTCTTATTCCTACCCATTTTTCTTTTTAATCCACAGACGAACGATTTCNAACTCATCCNNACTGCCTAACANCACTTA
ACTTTTCAGTTTCATTCTATGTTGAGCTACTTCCNAGGAATAGCAACACCTCTCTAANGAAGTGATTGAAATTCCCATAN
AAATCNAACATCTCCTGGGTACCATTTAAAGCTTGCCCTGATTCTNATCTTTATCNNGCAGTGTCCCACTTAATANCNNA
GTACCTGGA

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 59461155..59461642 454
NO GENE  


Sequence tag IST10731E9HMR1
Sequence
GGGTTCCAGGCGGGCACCGGTACATTCTCCCTGCCTTGTCTGGGGTTCTTAATTTGCATGTGACTTAAGATGACCTTCCC
ATAGGGTGATTTGTCTAAGTAAACAGCAGCTTCCCAAGTGGGTTCCATGAGAAACTAAGAGTCNNANAACTTAGGCACCA
CAGGGGGAAAGGGTTCTAGAGATTAAAAAAAAAANTCNGGGCCNNGCNAN
Sequence Type genomic DNA
Unitrap ID UNI8198

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 59461640..59461842 193
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035168 (Tanc1) NM_198294 tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1 Gene [Source:MGI (curated);Acc:Tanc1-001]

 
Come back to gene ENSMUSG00000035168


For any suggestions or comments, please send an email to unitrap@crg.es