Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14486B6
Clone ID IST14486B6
Vector VICTR74
Project tigm

Sequence tag IST14486B6HMF1
Sequence
CTCACCAACTCATGCTTCAAAATTCAAGACACACACAGGGAGGCAAAGCCAGAAGGCCCTGTCCTCAGTCCATTTCCTTC
AATCTGTTACCACGGACACATGCTGTCCCAAGAAAATGGTACAGATAAAGGACTGCAATCAAAAGTCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 114464622..114464768 147
NO GENE  


Sequence tag IST14486B6BBF1
Sequence
CTCACCAACTCATGCTTCAAAATTCAAGACACACACAGGGAGGCAAAGCCAGAAGGCCCTGTCCTCAGTCCATTTCCTTC
AATCTGTTACCACGGACACATGCTGTCCCAAGAAAATGGTACAGATAAAGGACTGCAATCAAAAGTCAACAGAAGGCGCT
GGAGAGCGCTCAGATTTCTCAGGGGACCCCTCGCAGCACCACGTGGTANCTCACAGGCCCCTGTAACTCTGGTCCCAGGC
ANACATCTTCCTCTAACCTCCTCCAGCATCAGGAACATGTTGTGGTANACAGACATACNAACAGGCAAAATACTCTCACA
CATAAAACTAATTAAATTTAAAAAAAAAAAAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 114464622..114464972 343
 
EST/CDNA Est Name
  BE335828.1


Sequence tag IST14486B6HMR1
Sequence
GTGAGAAGCCCTGAGATGGAGCAGTGGAGACTCAGACCTTTAATCCCAGCCCTCCCGGTGGCAGAAGCAGGCAGATCTCT
CAAGTTCAAGAACAGCCTGGTCC
Sequence Type genomic DNA
Unitrap ID UNI536

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 114464525..114464626 102
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079259 (Trim71) NM_001042503 tripartite motif-containing 71 Gene [Source:MGI Symbol;Acc:MGI:2685973]

 
Come back to gene ENSMUSG00000079259


For any suggestions or comments, please send an email to unitrap@crg.es