Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10888D9
Clone ID IST10888D9
Vector VICTR76
Project tigm

Sequence tag IST10888D9HMF1
Sequence
GACCCACCACACCAGCTCGCGCTGCTCAGACCCCTGCTTCTCCCCATTGTTGGCAGTGACCCTGTGCTCACCATGTCGCA
ACTTCGGAGCTTGCCTGAGCACAGTCCACAGAATCCAGCGGCAGGACAAGGAGCACAGCACACAGGCCCATTCAAGCCTG
CTCAGCGACTAATTGAAATTCGCGCCAAGGCATCCGGAAAAACCCGCCTTCCCTTCTGACTGGCAGGTCAGCCTAANNGC
TCTGATTGGA

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 121817871..121818119 245
NO GENE  


Sequence tag IST10888D9HMR1
Sequence
GTCTTTCCNGGGACTGACTGGGAATCGGCGGCCACGTGTGAGGTCCCCTGAGGTCCTAGCCNCN
Sequence Type genomic DNA
Unitrap ID UNI1559

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 121817813..121817873 59
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078564 (BX000432.7) Novel zinc finger protein Fragment [Source:UniProtKB/TrEMBL;Acc:B1AZK8]


Sequence tag IST10888D9BBF1
Sequence
NACCCACCACACCAGCTCGCGCTGCTCAGACCCCTGCTTCTCCCCATTGTTGGCAGTGACCCTGTGCTCACCATGTCGCA
ACTTCGGAGCTTGCCTGANCACAGTCCACAGAATCCAGCGGCAGGACAAGGAGCACAGCACACAGGCCCATTCAAGCCTG
CTCAGCGACTAATTGAAATTCGCGCCAAGGCATCCGGAAAAACCCGCCTTCCCTTCTGACTGGCAGGTCANCCTAAAGGC
TCTGATTGGCNNATAAGTCTTGAGTGACTCGAGCACCTNCCTTAAAGGTACTCTGTGTAGAGGTTCTCCGCCCTANCTTC
AACTCCAGTGCCTGACCTTTTCCAGATCTG

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 121817872..121818219 336
NO GENE  

 
Come back to gene ENSMUSG00000078564


For any suggestions or comments, please send an email to unitrap@crg.es