Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14549A7
Clone ID IST14549A7
Vector VICTR74
Project tigm

Sequence tag IST14549A7HMR1
Sequence
AGGTGCCACCTATCTTTGTGTTGCTACCATTTCTCCCTGGCCTGGANCTCGACAAGTAGGCTAAAGCAGCTGCTCANAGA
GGCCCGGGCTCCACCATCTCTACCTCATCAGTGTTCACAAGTTGCCGCTGGGAACTGAACTCCAGTCCCTAAGCACTTTA
NCTTTCTCTTCTCTTCCCCTACCCCATTATTACTGCGTTTCCCTTTTTGAAAGGGTATTATTGCGTAGCCCAGGCTANCC
TTAATCTGTGCAACCCCTGCTGTANCTTCCTACATTCTGGACTTATGGCCCAGTGCCCCATACCTGGCTAGCATATTGTT
TTCNAAGTTCACCCANNCCACAGCCTGCCTGCACCCAATTCCCTCTTTTATCGTTAGGTAAGCATACAACATTTGTTCTG
TTTAACCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 36135462..36135868 391
NO GENE  


Sequence tag IST14549A7HMF1
Sequence
ACCTGAGGAATGACACCTGGGGTTGTCCACTGGTCTTCACATGTATGCACATGCGTGTGTGTGCACTCACACACACAGTC
TCTCTATCACCCATACACTCTTTCACACACACACTCTCTCTCTCTCACACACATACACACACTCTCTCCCTCCCTCCCTC
CCTCTCTCTCTCTCNCACACACACACACACACN
Sequence Type genomic DNA
Unitrap ID UNI31609

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 36135865..36136056 190
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030494 (Rhpn2) NM_027897 rhophilin, Rho GTPase binding protein 2 Gene [Source:MGI (curated);Acc:Rhpn2-001]

 
Come back to gene ENSMUSG00000030494


For any suggestions or comments, please send an email to unitrap@crg.es