Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14350A5
Clone ID IST14350A5
Vector VICTR74
Project tigm

Sequence tag IST14350A5HMF1
Sequence
ATNNCAATGCCTGCCCCAATTTTAAAAGTGCGTGGACATTTACACAAAGAAGCAATCACCAGCAGATATGAAGCGACACA
AAAAAATGAATAATTATGTAATATTCTAGTGACTCAAAACTGGAATCACAGTAAATTTTACTCATGCTCATGCTTAAAGG
ATGAACTGAGCCTGCCCCATGCTCCCCACGAGCTCGGGTGGGTTTTAAATGACACAGAAACACAGCTGGGAGGCAGTCAG
CAGCAGGGCAGGCACCAGGGCCCTCANAACGCTGCGGCTTAAACACTTCTAACAAAGATTCAAAACGCCTCGGTTGGGAA
GTTCAAACTGANTGTTTTCCCATTTGCCATTGCCCTGTGTANAACTGACTTCTGCAACANGCNTGTANNATGGCNNGGGG
GGACCCTGGGTGCTCTNCNGCAGCTTGTTTGCTTCTNAANNGTTGANCNTCTCACANNANACCTTCNNCAGGCTGTGNNC
CNCCNTGANNTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14350A5HMR1
Sequence
NNTGATATTACCTTTAAGAGAGTTTCCAGTTTAAATCTCAGTCAGGATTTTGCAGCCTGTTACTTCGTATTCTCCCTGAT
GTTGTTTCATATCAGTTTTAAAAAGTACAGTTCTATTTACGAGAAACCATAATATCTGTTTTAAATGCNCCAATTATGTA
AAAGAATGGGGAGGTGGN
Sequence Type genomic DNA
Unitrap ID UNI11610

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 73581876..73582050 173
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000070733 (Fryl) NM_177136 furry homolog-like (Drosophila) Gene [Source:MGI (curated);Acc:Fryl-001]


Sequence tag IST14350A5BBF1
Sequence
ATCACAATGCCTGCCCCAATTTTAAAAGTGCGTGGACATTTACACAAAGAAGCAATCACCAGCAGATATGAAGCGACACA
AAAAAATGAATAATTATGTAATATTCTAGTGACTCAAAACTGGAATCACAGTAAATTTTACTCATGCTCATGCTTAAAGG
ATGAACTGAGCCTGCCCCATGCTCCCCACGAGCTCGGGTGGGTTTTAAATGACACAGAAACACAGCTGGGAGGCANTCAG
CAGCAGGGCAGGCACCAGGGCCCTCAAAACGCTGCGGCTTAAACACTTCTAACAAAGATTCAAAACGCCTCGGTTGGGAA
NTTCANACTGANTGTTTTCCCATTTNCCNNTGNCCTGNNNANAACTGACTTCTGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 73582047..73582420 346
 
EST/CDNA Est Name
  AA217426.1

 
Come back to gene AA217426.1


For any suggestions or comments, please send an email to unitrap@crg.es