Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AA0243
Clone ID AA0243
Vector pGT0lxr
Project sanger

Sequence tag AA0243
Sequence
TTTTTTCAATCTTCGGAGTTAAAAAAGTGAGGAATGATGTACAGCTGCTCAGTTGCCTTCGACAGCTTGGAGATGCTGAG
GGAAACGCTGCAGCCCTGGTGAAGAAGATCTGACTAGGGACGGGTTTGGATCCATACCAGGCTGGTGTGGATTGGGGCTG
GTGTGGACGGCTTACTCTAAACCCCTGCTTAAGGAATTCCTGGAAGCCTCGGGAAAGTACTCCCCAACCAGTCGTGGTGG
AAATGGCTTTGCCACACAGTGAAGATGCCATCACAGGGGACACTGACAAGTATCTCGGGCCACAGGACCTTAAGGAGCTA
GGTGATGACTCCCTGCCAGCAGAAGGTTACGTAGGCTTCAGTCTTGGAGCCCGTTCTGCCAGCCTCCGCTCCTTCAGTTC
GGATAGGTCCTACACCTTGAACAGAAGCTCCTACGCAAGGGACAGCATGATGATAGAGGAACTTCTGGTACCATCCAAAG
AGCAG
Sequence Type mRNA
Unitrap ID UNI2979

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 69388682..69395244 260
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000069601 (Ank3) NM_170687 ankyrin 3, epithelial Gene [Source:MGI Symbol;Acc:MGI:88026]

 
Come back to gene ENSMUSG00000069601


For any suggestions or comments, please send an email to unitrap@crg.es