Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14634F11
Clone ID IST14634F11
Vector VICTR74
Project tigm

Sequence tag IST14634F11HMR1
Sequence
TATGTATGCGTCACGTATATATTTACTGCAAATGGTGGGGATCATTTAGTGCCCGAGATGGGAGACCTGAAGTCAGGTTT
CGAAGAGGTGGATGGCGTGAGGCTCGGCTACCTCATCATTAAAGGGAAGCAAATGTTTGCTCTCTCCCAAGTCTTCACAG
ATCTGCTGAAAAACATCCCGAGGACGACCGTGCACAAGCGCATGGATCATCTGAAAGTGAAAAAGCACCACTGCGATCTG
GAGGANTTGCGGAAACTCAAAGCAATCAACAGTATCGCCTTCCACGCGGCCAAATGCACGCTNATCTCCCGGGAAGACGT
ANAAGCGCTCTACNCATCCTGCAAAACCNANCGTGTGCTNANNANCNAGCGANNGNNANTCN
Sequence Type genomic DNA
Unitrap ID UNI32079

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 17969652..17970023 350
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000054074 (2810030E01Rik) RIKEN cDNA 2810030E01 gene Gene [Source:MGI Symbol;Acc:MGI:1919918]

 
Come back to gene ENSMUSG00000054074


For any suggestions or comments, please send an email to unitrap@crg.es