Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13158H10
Clone ID IST13158H10
Vector VICTR74
Project tigm

Sequence tag IST13158H10HMF1
Sequence
CTGGGATTAAAGGCGTGCGCCACCACGCCCAGCTT
Sequence Type genomic DNA
Unitrap ID UNI1306 UNI31273 UNI34647 UNI35608 UNI35609

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 8957960..8957994 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 21040626..21040660 35
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033382 (D030074E01Rik) NM_029491 RIKEN cDNA D030074E01 gene Gene [Source:MGI Symbol;Acc:MGI:2443008]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 30051507..30051541 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 4612686..4612720 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 8244964..8244998 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 17151860..17151894 35
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000055137 (5033411D12Rik) NM_138654 RIKEN cDNA 5033411D12 gene Gene [Source:MGI Symbol;Acc:MGI:1923221]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 55737226..55737260 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 8535417..8535451 35
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020422 (Tns3) NM_001083587 tensin 3 Gene [Source:MGI (curated);Acc:Tns3-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 31789843..31789877 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 21636694..21636728 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 28072809..28072843 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 8247165..8247199 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 51424366..51424400 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 16448168..16448202 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 3597948..3597982 35
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000005907 (Pex1) NM_027777 plasmacytoma expressed transcript 1 Gene [Source:MGI (curated);Acc:Pex1-002]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 11224423..11224457 35
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000045205 (Dpy19l4) NM_001081201 dpy-19-like 4 (C. elegans) Gene [Source:MGI (curated);Acc:Dpy19l4-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 21919290..21919324 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 6042141..6042175 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 10232826..10232860 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 23972227..23972261 35
NO GENE  

 
Come back to gene ENSMUSG00000045205


For any suggestions or comments, please send an email to unitrap@crg.es