Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12378E8
Clone ID IST12378E8
Vector VICTR76
Project tigm

Sequence tag IST12378E8BBF1
Sequence
ATTATATGTAAATACACTGTAGCTGTCTTCAGACACCCCAGAAGAGGGCATCAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI8501 UNI34193 UNI34194

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 24597751..24597808 58
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 4032869..4032926 58
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 61732856..61732913 58
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047804 (Akap10) NM_019921 A kinase (PRKA) anchor protein 10 Gene [Source:MGI (curated);Acc:Akap10-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 122733231..122733288 58
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 73903136..73903193 58
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028397 (Jmjd2c) NM_144787 jumonji domain containing 2C Gene [Source:MGI (curated);Acc:Jmjd2c-006]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 121199740..121199797 58
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033498 (Strc) NM_080459 stereocilin Gene [Source:MGI (curated);Acc:Strc-001]

 
Come back to gene ENSMUSG00000033498


For any suggestions or comments, please send an email to unitrap@crg.es