Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11632D3
Clone ID IST11632D3
Vector VICTR76
Project tigm

Sequence tag IST11632D3HMR1
Sequence
ATTCTTCTAGCAGCTTCGGGGCCTGGGACGTGGGGAATCCTCTGAGGGAGCGGCGGGTGGCACCCTCTTCCCTTCACAAG
ATGGCGCCGTGGGAAGAGCCTGGGGCCCTGGCGGTCTCCANCCCGGTCTTTGGGGCTCTGTCCCGGCTACTGAGCCGGAT
CGCATCCGGGGTGACGGGGGTGN
Sequence Type genomic DNA
Unitrap ID UNI19128

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 53619021..53619202 180
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000017831 (Rab5a) NM_025887 RAB5A, member RAS oncogene family Gene [Source:MGI Symbol;Acc:MGI:105926]

 
Come back to gene ENSMUSG00000017831


For any suggestions or comments, please send an email to unitrap@crg.es