Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14374A9
Clone ID IST14374A9
Vector VICTR74
Project tigm

Sequence tag IST14374A9HMR1
Sequence
NTANCTAATCTGGAAATCCAAAATGNNCTCGAAAAGAAGTGGGTTTTGGGACGTTCTGATTTCTTTTCTTCTTCTTCTTT
TTTTTTTTTTTTTTG
Sequence Type genomic DNA
Unitrap ID UNI20161

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 150733939..150734031 87
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000059119 (Nap1l4) NM_008672 nucleosome assembly protein 1-like 4 Gene [Source:MGI Symbol;Acc:MGI:1316687]


Sequence tag IST14374A9HMF1
Sequence
CGCTCATCTGTCAGACCTACAAATATTCCACAAACCGAACCACTTCAAAACCCAGGCGTTTCTTGCTAATGCACAGTCAG
CCTGTTGCACCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 150734032..150734122 91
NO GENE  

 
Come back to gene ENSMUSG00000059119


For any suggestions or comments, please send an email to unitrap@crg.es