Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11795A3
Clone ID IST11795A3
Vector VICTR76
Project tigm

Sequence tag IST11795A3BBF1
Sequence
ATTATATGTAANTACACTGTAACTATCTTCANACACTCCAGAAGANGGCGTCAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST11795A3HMF1
Sequence
ATTATATGTAAGTACACTGTAGCTATCTTCAGACACTCCAGAAGAGGGCGTCAGATCTTGTTACAGATGGTTGTGAGCCN
CCATGTGGTTGCTGGGATTTNAACTCCGGACCTTCGGAAGANCANTCNGGTGCNCNTNCN
Sequence Type genomic DNA
Unitrap ID UNI35616

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 89798596..89798728 123
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 95979341..95979473 123
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 122237416..122237548 123
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 124530048..124530180 123
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 66226040..66226172 123
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038664 (Herc1) hect (homologous to the E6-AP (UBE3A) carboxyl terminus) domain and RCC1 (CHC1)-like domain (RLD) 1 Gene [Source:MGI (curated);Acc:Herc1-001]

 
Come back to gene ENSMUSG00000038664


For any suggestions or comments, please send an email to unitrap@crg.es