Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10067F6
Clone ID IST10067F6
Vector VICTR75
Project tigm

Sequence tag IST10067F6BBF1
Sequence
CCCCCACCCTAACTCTGTACTTCAAGATTTCCAGGCTAGGCGTTTCCTCTCCCACTGAGGCCAAACAATAAAACATATCC
CACATACATGTACAAGCAACAGCTTTTCGGATATCTCTCGCTCCAGTTGTTTGGGACCCACATGAAAATGAAGCTGCACA
TCTGCTACATATGTGTAGGGAAGTCTTCGTCCAGCACATGTATGTACTTTGTTTGGTGGTTCAGTCTCTGAGAGCCCTAA
GGGTCCAGGTTAGTTGACCTTGTTGGTCTTCCTGCAGAGTTCCTATCCCTTTCGTGGCTGGAAATCCTTTCTCTCACGGT
CTTCTGAATTCAGCCTATTTTAATTTACTGGTGAATTTCTGATTTGGGGTGGGAAGAATCTCATTTTGATGATTACACAT
AGTGAAGAAAAGGAATTCGATTCTAAAATTTCTGTTACTGGAGTTGGATACATCTACAAATTTTCTCAGTAACTGTTCAG
AATATTTGCTTTTATTTGACCATAATTCCAAGAGAATTTTCATAAATATTTTTATAGGCCTATTTTATTTTATTTTTTTA
AAGATT
Sequence Type genomic DNA
Unitrap ID UNI14329

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 30454199..30454764 566
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039697 (Ncoa7) NM_172495 nuclear receptor coactivator 7 Gene [Source:MGI Symbol;Acc:MGI:2444847]

 
Come back to gene ENSMUSG00000039697


For any suggestions or comments, please send an email to unitrap@crg.es