Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14959C1
Clone ID IST14959C1
Vector VICTR76
Project tigm

Sequence tag IST14959C1HMF1
Sequence
GTGATAATTAACGATACATCAACAGTAACAAAATTCACTTACCAGTTTGGCTGTTTAGGTAATCCCCTGCAACTCTTCCT
GGCTTTANACAATCTCTCATGTATTAACAATGGATCTGGTAAAGCTCANCTANGTAATAAAAGCTTGANNATATTTACAA
NTAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 101390026..101390188 151
NO GENE  


Sequence tag IST14959C1BBF1
Sequence
GTGATAATTAACGATACATCAACAGTAACAAAATTCACTTACCAGTTTGGCTGTTTAGGTAATCCCCTGCAACTCTTCCT
GGCTTTAGACAATCTCTCATGTATTAACAATGGATCTGGTAAAGCTCAACTAGGTAATAAAAGCTTGAAAATATTTACAA
ATATCACTTCTAACTANCTTCATTTTTTTCCTTCTTGATTACATTATTATTCCATGATAGGTCANATTTANATTGGGGAA
CCACCTTTTCATTCACTCCTGCTCCCGATTAATGAANTCCATCACAGANACTTANGACTGGGANGCNNACNACTTANAAG
ANCATCTTGTCTA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 101390026..101390357 308
NO GENE  


Sequence tag IST14959C1HMR1
Sequence
TNNCCTTTCTCTCTTCTGCANTAACCTAAGTTTTGTGGCACGACGAAGTTCTTTCCGACTCCTTTCCCATTGTTTGCCAT
GTTGTTCTGGGCACATGTGATTTATTAACCCAGAAGCTGGTCTTGATGACTCCTATAAGCAGAAACTCACTTTCTCTTTC
TTTACTTGTTAATAAGTGAACCACACCCAGAAGATACACCGCCTTACTAAGTANAGGAGTAGAAAAAGGACCAATACCAT
TTANATCAGTGTTCCCTAACCAGTAATCTCTAATTGCANCATGAATTGGTATGAAAATTTGAAGGCCACTGANTGCANGC
TCTTCANAGAACTGCATGTTTACCTACATATATACCATATGCATACATTTCAGGAAGACCANTCGTGCATTGTGAGTTTA
AAAACCTCTGCATAACCNGGANGTGGTGTCNCC
Sequence Type genomic DNA
Unitrap ID UNI30077

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 101389600..101390026 407
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000046449 (C77370) NP_001070822 Uncharacterized protein KIAA2022 [Source:UniProtKB/Swiss-Prot;Acc:Q5DTT1]

 
Come back to gene ENSMUSG00000046449


For any suggestions or comments, please send an email to unitrap@crg.es