Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10074A5
Clone ID IST10074A5
Vector VICTR75
Project tigm

Sequence tag IST10074A5BBR1
Sequence
CTTTCTGTGTCTCCCAGTAATGCACAGAACACAACTTTGTTGGAGTAGAATCTCATTCTGTAGCTCAAAATGGCCTGCAG
CTTAACAGTCCCTCTGCCTTAACCTCCCTGGAATCGCAGACATGCACCACCACGCCCAGCTCAAAACATGCATTCTTTGC
TCTGCTTCCCAGCCTTCCGGGGGCAGCTGCTGGCTGTGCAGTCTTCCAGGGCCAGCTCCTGGCTGCCCCTCACTGGCCAG
CTCCTGGCCGACTCTCACAGGCACTAGTTTGTGCCTGTCACTTTGCTCACTGCCTTCGTCACTCTGGCCTCACTTCAGTC
CTTGACAGGACAGGCTCGCCCCCAGAGCCCCTCACCCCTCAGTTTCTGTTTTATGAAATCCATCATCCCTGAGGTTACCA
GCCTGCTACTATCAAGTCCACTCTCTCAAAGAAAAAGAGCAGCCAATCTCAGGAGGGCTTTCCTGGGGCACAGTATCATG
TTGTTATATTTTGCATAGAACATCCATTAAAAA
Sequence Type genomic DNA
Unitrap ID UNI7146

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 56863451..56863960 495
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038816 (Ctnnal1) NM_018761 catenin (cadherin associated protein), alpha-like 1 Gene [Source:MGI (curated);Acc:Ctnnal1-001]

 
Come back to gene ENSMUSG00000038816


For any suggestions or comments, please send an email to unitrap@crg.es