Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13505F8
Clone ID IST13505F8
Vector VICTR74
Project tigm

Sequence tag IST13505F8BBF1
Sequence
CCTCTCCTCAGGTTTGCACCAAAGGCTCTCGGATCT
Sequence Type genomic DNA
Unitrap ID UNI35617

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 32613065..32613099 33
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039021 (Ttc16) NM_177384 tetratricopeptide repeat domain 16 Gene [Source:MGI (curated);Acc:Ttc16-001]

 
Come back to gene ENSMUSG00000039021


For any suggestions or comments, please send an email to unitrap@crg.es