Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST466846
Clone ID OST466846
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST466846
Sequence
GACTGAGGTTGTTGGAAAGGACACCAATGTCATGTTGGTAGCTTTGGCAGCAAAATGTCTTACTGGCTTAGCTGTTGGGC
TCAGAAAGAAATTTGGACAATATGCAGGACATGTTGTGCCAACAATTTTGGAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI16070

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 91400962..91402934 109
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040549 (Ckap5) NM_029437 cytoskeleton associated protein 5 Gene [Source:MGI (curated);Acc:Ckap5-001]

 
Come back to gene ENSMUSG00000040549


For any suggestions or comments, please send an email to unitrap@crg.es