Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10173C12
Clone ID IST10173C12
Vector VICTR76
Project tigm

Sequence tag IST10173C12HMF2
Sequence
CAAGAATCTGGTCCCAGGATATCTGGCTCCCAAGACTGTGTTCCCAACCAATTCCTTAAAGTACCCCTCAAAATAAGAAC
AATAAAATATCAGCTCCACAATAGGGAGACTATGTGGTCTGCTGCCTCTCTTGATTCTNATGAAAGTATGTAACTGGGAA
AAAGACAGACTGTGGCTCATGGGCAAGTAAATCAAAGTTTTCTACCTNTACAGAGTTCTAAAGACTGAAAAAGAAAGCAC
TTACTCANAAAANCCTTTCCACTTCAACAGATATTCCACTTGCCCCTTAACCNTGCGCCTGTCCAACACCTTTTCCACCA
CATATTCCTCCTCATCCTCTGAAGAAGAGCTGTCGGCTGTCCTCTTGGTCTTCTTTCCCATGTCGTGTGCCTGTTGATCN
NCCTGAANGANTATGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 103043259..103043674 398


Sequence tag IST10173C12BBF1
Sequence
NACACAAAGTTCCCCACAGACTTCCTAGGTGGTCAGCCTTGGCCCAGAGGGCCACCAAGTTGGTTTTGTCTTTCGCTCTC
AAGTGTTTTGTAATTCCCCTAAGCCTGCGTGGTCCTTACTCAGAACTACTATTTAGTGACACTTGANAAAAGACTTTGAA
AATCATATTTAACTTGGAAAGATGCTTCTGTATAAGGCACATATTGCAGCTAGGTGGTGTGGTATGGTGCTGGCGCACGT
CTTANTACAGCACTTGGGANNCNNAN
Sequence Type genomic DNA
Unitrap ID UNI13159

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 22413794..22414051 254
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000013089 (Etv5) NM_023794 ets variant gene 5 Gene [Source:MGI Symbol;Acc:MGI:1096867]

 
Come back to gene ENSMUSG00000013089


For any suggestions or comments, please send an email to unitrap@crg.es