Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14395H8
Clone ID IST14395H8
Vector VICTR74
Project tigm

Sequence tag IST14395H8BBF1
Sequence
GGTTAAGTCTATTTTTCTTGGATGCTTTTCATTGCAAGTACTTTACCTAAGTCATCTCATTCAAAATTTCAATATTCTTC
TCTTAAAAGTTTTCAAAGACTAAAGGCACGTTCTCCAAAGTCTCAAGTGAAGGGAGGAACGTACCAAAAACTACAAGAAA
AATGATTAACTCAAGGGCCACAAGAAAACATATGTTTTCCCTAAGGTAATATACAGAATGAATGCCTTAGTTATAGGAGT
CATTTTAAGTTAAAATACTCGCCCCCACAAATGCAAGAGTAAGCTTTATTGGGGGGGGGNGGGGGGAATCCTGTCTTTCT
AGTGACTCCTGGCTTGCTCTAAGAATTTNACCNGCCNACTCCCGCGCTCCCCACANGANTCNANNNNNNGCCTCTT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 103069404..103069799 370
 
EST/CDNA Est Name
  CA533446.1 - CA888737.1 - AI047093.1 - BE626739.1 - BE303809.1 - CA890043.1 - BQ559129.1 - CA881163.1 - DV046841.1 - BB840113.1 - CJ173696.1 - CK391282.1 - CJ100309.1 - CJ075042.1 - CA876098.1 - BY302816.1 - BY010828.1 - AI324457.1 - BY082206.1 - BY298407


Sequence tag IST14395H8HMF2
Sequence
CCTTTCCTGACAAATGCTCAGACCAATCTAAGAACAAAAATGTAAGGAAACCTTCATGGTAGCAAATTTATGTGCACATC
CTCTGGTAACCGCAGATGAATAAATCAAAGTTCCCGTCGTTGCTGACTTTGCTAATTTAATTAAGCCGTCGAAATTTTTC
CCCTTCTTTAGCCTTTTGAGTGCTTTTATGTCTGGGAAAACGTAAAGGAATTTTTGTGTGTTAGTGAAGAATAACAACCA
CATATAAAGTGGCTTTCTATGATGAATGGCAACCTTCCTAAGCCTTGCCAGCACATTCTTATATTTAATCCCTTAGCGGG
CAGGGATTTATACGCTGTTTTATACATTAAAAATTTTCCTTGGTGAAGTAAAGAGCCTTCCTTCATCAGGCTGGGTATTT
TATAACN
Sequence Type genomic DNA
Unitrap ID UNI8198

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 59463914..59464319 406
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035168 (Tanc1) NM_198294 tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1 Gene [Source:MGI (curated);Acc:Tanc1-001]

 
Come back to gene ENSMUSG00000035168


For any suggestions or comments, please send an email to unitrap@crg.es