Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15113D10
Clone ID IST15113D10
Vector VICTR80
Project tigm

Sequence tag IST15113D10HMR1
Sequence
AACAAACAAACAAACAAAAAAGGAACATTTAACAAACAAACAAACAAAAAAGGAACATTTAACAAACAAACCAAAAAAAA
GGGAACATTTAACAAACAAACAAACAAACAAACAAGGAACATTTAACAAACAAACAAAAAAGGAACATTTAACAAACAAA
CAAAAAAAGGGAACATTTAACTAACAAACAAACAAACAAACAAAAAAGGAACATTTAACAAACAAACAAAGGAACATTTA
ACAAACAAACAAAAAAAGGAACATTTAACAAACAAACAAAAAGGGAAAATTTAACAAACAAAAAACAAAAAAANAACATT
TAACAAACAAACAAACAAAACAAAAAACAAAAAAGGAACATTTAACAAACAAACAAAAAAGGAACATTTAACAAACAAAC
NNAAAAAAAAAAAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 106587150..106587563 408
 
EST/CDNA Est Name
  CF165785.1 - CF164416.1 - CN680180.1


Sequence tag IST15113D10HMF1
Sequence
GTTAAATGTTCCTTTTTTGTTTGTTTGTTTGTTAAATGTTCCTTTTTTGTTTTGTTTTGGTTTTTTGTTTGTTTGTTTGT
TAAATGTTAAATGGTTTTAAAGGTCTGATCCTCCTGACTCCACAAGAGCTGAGATTGCACGGGTGAACCGCCACGCCAGT
TTGCAGGATGTTTTGGATGGAACGCAGGACGCTGTGCATGCTAGGGGTTTCGAGTTTTTTGTTTTGTTTGTTAAATGTTC
CTTTTTTTGTTTGTTTTTTGTTAAATGTTCCTTTTTTTGTTTTGTTTTGGTTTTTTTTGTTNGTTTGTTAAATGTTCCTT
TTTNNGNNNGTTTGTNAAANGTNCCTTTTTTGNTNGTTTGTTNGNNNGNTNGCCN
Sequence Type genomic DNA
Unitrap ID UNI14271

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 106586791..106587152 340
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020717 (Pecam1) NM_008816 platelet/endothelial cell adhesion molecule 1 Gene [Source:MGI (curated);Acc:Pecam1-002]


Sequence tag IST15113D10BBF1
Sequence
TTTAAATGTTCCTTTTTTGTTTGTTTGTTTGTTAAATGTTCCTTTTTTGTTTTGTTTTGGTTTTTTGTTTGTTTGTTTGT
TAAATGTTAAATGGTTTTAAAGGTCTGATCCTCCTGACTCCACAAGAGCTGAGATTGCACGGGTGAACCGCCACGCCAGT
TTGCAGGATGTTTTGGATGGAACGCAGGACGCTGTGCATGCTAGGGGTTTCNAGTTTTTTGTTTTGTTTGTTAAATGTTC
CTTTTTTTGTTTGTTTTTTGTTAAATGTTCCTTTTTTTGTTTTGNTTNGN
Sequence Type genomic DNA
Unitrap ID UNI14271

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 106586866..106587151 282
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020717 (Pecam1) NM_008816 platelet/endothelial cell adhesion molecule 1 Gene [Source:MGI (curated);Acc:Pecam1-002]

 
Come back to gene ENSMUSG00000020717


For any suggestions or comments, please send an email to unitrap@crg.es