Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14393F7
Clone ID IST14393F7
Vector VICTR74
Project tigm

Sequence tag IST14393F7HMR1
Sequence
CTGGGAACTGCCAAAGCAACACAGTATCTGAGAAAGGTCCTGTTTTGGGCCTTCTTCTTCGGCCAGGAGGAGGTCCAAAT
ACAAGATATCTGCGCACCTTCCCTGTAAGAGAGCTTGCCAGCANAGAGTGCTCTGAGCACTGAAACTCAGAGGAGAGAAT
CTGTCTCCCAGGTCTGCTGATAGACGGTAACAGAATCACCAGAAGAACANTCTCTAAACNGANTCC
Sequence Type genomic DNA
Unitrap ID UNI15854 UNI35621

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 28247079..28247303 217
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019889 (Ptprk) NM_008983 protein tyrosine phosphatase, receptor type, K Gene [Source:MGI Symbol;Acc:MGI:103310]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 157763973..157764197 217
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028176 (Lrrc7) NP_001074827 leucine rich repeat containing 7 Gene [Source:MGI Symbol;Acc:MGI:2676665]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 70600937..70601161 217
NO GENE  

 
Come back to gene ENSMUSG00000028176


For any suggestions or comments, please send an email to unitrap@crg.es