Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12072F10
Clone ID IST12072F10
Vector VICTR76
Project tigm

Sequence tag IST12072F10HMF2
Sequence
CTTTGGTCATCTGGTCAAGGCAATGCAAGTTTTTATGCATATATATGTATGCATATATATTTGGTTTCTCTTTCTTTCTT
CCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTTTTTTTGGTTTTNNNAANANAGGGTTTTTCTGTATAGCCCTGGCTTT
CTTGGAACTCACTTTTAAACCAGGCTGGCCTTGAACTCANAAATCCACCTGCCTCTGCCTTCNGANTGCTGGAATTAAAG
GTGTGTGCCACCNCTGCCGGNNNAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 102227909..102228168 240
 
EST/CDNA Est Name
  CK372110.1


Sequence tag IST12072F10BBF1
Sequence
TTCAAGGAACACAATAAAACTCCTCACCTCTTTTCTCTTCCCATCATGATTTAGCTGAAGCAATTCATTAAGTGTCACTG
GTTTTCTGGGTTGCTGGAGCCATTCCAATTTCAGTGGCAGTGATACAACTTGGCATACTGTTAGATGCTTTTCATGGAAG
AAAAGTGATTGCTGGCTGAGATAAAGGCTAGGTCTGCTCACAGAAACTGTTTGGTTTGGCTAGACTATTCCATTGTCCAT
TGTTCCTTCTGGAGAATCTGCCAGTCNCCGTATAATCNNTAANCCTCANGAAGGTTTTATTTTGCTTCCTTCTTATCTCC
CAAAAGNNGACTGCAGATTCTTTGGAGAACACAGATGAAAGAGCATTANTAAGCGACTGTTTAAGTCAGTGCAATTTACA
TAGCTGTTTTGGAAGAATTTTGTACGACTTCCAGCTGATCCATTTTTGTTTNNNGCATACAAGANAAACATGTTTGCCTG
TANNNAGTTAAGTATCATTGAATCNNGTACCNNGCNTGTGCACTANNGNCTNAN
Sequence Type genomic DNA
Unitrap ID UNI31033

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 44904022..44904544 483
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000071856 (Mcc) NP_001078843 mutated in colorectal cancers Gene [Source:MGI Symbol;Acc:MGI:96930]

 
Come back to gene ENSMUSG00000071856


For any suggestions or comments, please send an email to unitrap@crg.es