Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14464E3
Clone ID IST14464E3
Vector VICTR74
Project tigm

Sequence tag IST14464E3HMR1
Sequence
TNGTGATACACACCTGTAGTTCTGGCATCCTGGAGGCTGAGGCAGGAGGCTCATCTTGAGCTTAAGGCAAACCTGGGTTA
TATAATAAATTCCAGGCCAGCCTGAGCTAAATAGCAAGAACCTATCTCAAAACCAACAAAACCCAAATGTAAATATGTTG
GTAACTTGGTTGATGGCCN
Sequence Type genomic DNA
Unitrap ID UNI17568

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 95169488..95169663 176
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038909 (Myst2) NM_177619 MYST histone acetyltransferase 2 Gene [Source:MGI (curated);Acc:Myst2-002]


Sequence tag IST14464E3HMF1
Sequence
CTATACCCAGCAAGAACTTACATTTTCTTCTTCTTTTTGAGTCNGGACACCCCAGCATATCAGCCATGTGTACCTCAAAC
TATAGAGATCCACCTCCCAAGTGCTGGAATTAAAGGCTTGTACCATAACATCCAGGAAGAATTTACATTCTCCACTTTTA
CATTTGGAAACTGCTAAAAGGAGACTAGATCATTCCAACAAACCAGTAGGTCTGTCTCTTGTATTTGGTATGCCTGGATA
TAAATACTACCTGTCGAGCTGATGANATGGCTCAGCAGGTTAAGAGCACTGACTGCTCTACCGANGGTTCTGANTTCAAA
TCCCANCAACCACATGGTGGCTCACAAACACCTGTGCCCTCTTCTGGTGCGTCTAANCTCAGCTACAATGTACTCATGTN
TAATAATAAATAAATCTTTGGGCCTGANTGANCNNAGNTCCNAAAAATTNAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 95169663..95170111 423
 
EST/CDNA Est Name
  CF900406.1 - CF900296.1 - BU504316.1 - CF737680.1 - CK392587.1 - BQ890895.1 - BB638276.1 - CA979216.1 - CF896603.1 - CN701210.1 - CB244152.1 - CJ066440.1 - CB519300.1 - CF897706.1 - CF169559.1 - BG808984.1 - CF739264.1 - CN672058.1 - CF907861.1 - CN704789

 
Come back to gene CF900406.1 - CF900296.1 - BU504316.1 - CF737680.1 - CK392587.1 - BQ890895.1 - BB638276.1 - CA979216.1 - CF896603.1 - CN701210.1 - CB244152.1 - CJ066440.1 - CB519300.1 - CF897706.1 - CF169559.1 - BG808984.1 - CF739264.1 - CN672058.1 - CF907861.1 - CN704789


For any suggestions or comments, please send an email to unitrap@crg.es