Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14678A2
Clone ID IST14678A2
Vector VICTR74
Project tigm

Sequence tag IST14678A2HMF1
Sequence
ATAGCACGGCCAGCAGCAGTGCCCTCAGCCCCGTGCCGTTGGTGGCTCCAAGGCTGACTCTGGTCAGCATCAAAGACAAG
TAAATGAGTAGGCAGGATGGCTGGCACCTGAGGCCCCTAGTGCCGAGTGTGCTCCCTCCGAGCAAGAGCAGCTGCAACCG
AGCAAGAAAGCGGCCCTCTCCAAGTCCAGATAGAAAATGGAAGAAAAGGGCTCTCAGCTCCCTAGCTTTCCCTCCTCTTT
CGCTTTGANNNCAACTGCTTTCCTGGTCCTAGTGGACCTCAACCTCTCCTTTGTCGTGGCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 87343719..87344018 294
NO GENE  


Sequence tag IST14678A2HMR1
Sequence
TATAAACTCTGGGCTTATGATATTCTCAGTNAGCCACAGCAGAGCCTGGAGTTTGGCGGGTGGGTGCCAGGTCTTTCCTC
CCTGCCGGCCCATCTCTGACTGATCGACCTGGANAATTCACCCCCTACTCCAAACACAGGGACTTGGAAACTGACATTGC
GAAGACCCATCTGTACCCTGTCTAGAGGGGCCTGAGGGTATCACCCTGGTGGGCCACATTCCTTTTTTGGTGGTTTACAG
CTGCCCCTGGCTGCCTGTGTTTCCAATCCTCCACTCATTCTTTACTTCCCTTANTCTGATCGCCCCTGANCCTTTTCCAG
GGAACCTCAACGTTTGGAATTCTAGGGACTTANCCCAGTAAGTACTTCCTACTGCCCGCACTCNANCTTCCTCCCCTGCA
AAGTCNCCTCANGCTTANNTACCTTGCAAANTCATCTTGGGAAATTCNTAANACTTGGTGCATTCGGANGGCATCANNCA
CATANGTNNCNNCN
Sequence Type genomic DNA
Unitrap ID UNI24496

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 87344016..87344502 451
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030539 (Sema4b) NM_013659 sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4B Gene [Source:MGI (curated);Acc:Sema4b-001]

 
Come back to gene ENSMUSG00000030539


For any suggestions or comments, please send an email to unitrap@crg.es