Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12497C6
Clone ID IST12497C6
Vector VICTR76
Project tigm

Sequence tag IST12497C6BBF1
Sequence
CTTTCACGGAACGCCGTCGTTTCTCGGCTCAGGCCCCGCTACGGCCCCGCCTGGGCCTGGGATCT
Sequence Type genomic DNA
Unitrap ID UNI17198

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 91648297..91648360 64
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022961 (Son) NM_019973 Son DNA binding protein Gene [Source:MGI (curated);Acc:Son-001]


Sequence tag IST12497C6HMF1
Sequence
AGGAAGAAATGGTTTTCAGTTTACATTTTCTTCCTGTTGCCTGCTTTTCATTAGTCTGAGGTCATCTGTTTGGGTCTGTT
TTTATAATTAGTCTGCTCCTTAGATCCCATCGGTCTGGCCCCCTTTGCCGTTCTGCCAGATCCTATGCTGTACGCTAAGT
CACCTCGGGGTGCGAGCACATGTGACTCTCAGCTGCAGCTGGGGTCCTAAATGTCACTCTCTGGTGATCTGTGTCTAGAA
GCACTTAAATTGATTAATGCTTTTAGTAAGTCTCTGGGCTGCTACACTGACCCTACCAGGCTGCCCTCTCANACGGAGCT
GTAAGCANGCANGAGGGAAGGNCTNANNTGTGNNGNAN
Sequence Type genomic DNA
Unitrap ID UNI16319

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 100183805..100184156 338
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041632 (Mrps27) NM_173757 mitochondrial ribosomal protein S27 Gene [Source:MGI Symbol;Acc:MGI:1919064]

 
Come back to gene ENSMUSG00000041632


For any suggestions or comments, please send an email to unitrap@crg.es