Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11667D3
Clone ID IST11667D3
Vector VICTR76
Project tigm

Sequence tag IST11667D3HMR1
Sequence
CCTTGAAATTGTTTTANTTTAAAACAGGGTCAGCCTGGGAGTGCAGCTTTGATGTGTTACTTTGTAGCCAGGTTGGTTTC
TAACTCATTGAGTAGCCTCAAACTTGTTGCAGTCCGGGTCTCTATAAGTCCAAGTGCTGCCATGCTCATCTTCTGATAAG
AGTTGTANCTATTTTGTTTGTAAAATGGGGANTGNANAN
Sequence Type genomic DNA
Unitrap ID UNI15223

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 41219205..41219398 188
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028433 (Ubap2) NM_026872 ubiquitin-associated protein 2 Gene [Source:MGI (curated);Acc:Ubap2-001]

 
Come back to gene ENSMUSG00000028433


For any suggestions or comments, please send an email to unitrap@crg.es