Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14536B4
Clone ID IST14536B4
Vector VICTR74
Project tigm

Sequence tag IST14536B4BBF1
Sequence
GCAACAGAAACCCAAAGACAGACTTGGGAATGCTTGGCACACCAGTGCGTTCGTTCCGAGCCATTCAGTTAGAGCGAGAC
CTAATTTAAAGACACACACACACACACACACACACACACACACACNCNNNANAT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 35139032..35139156 125
NO GENE  


Sequence tag IST14536B4HMR1
Sequence
TTGCNNTGTTTAAAACAACATGACCNAAGCGCCTTGGGAAAGAAAGGAATTGTTTCAGGTTACAGCTCTCCATCACTGAA
GGAAGTCANACCAGTGACTGGAAGCAGAAACAAAAAGAGGCCGTGCAGGACCGATACTTTCTGGCTCACTTTCCACAGCT
TGTTCAGCCTGCTCTTTTATACCGTCCAGGGCTGCTTTGCCAGGGGTGGTATCCCCTACAATGGACTGGCCCTCCACATA
ATCATTANTTAANAAAACNTCCCCACACGCTTACCCACAGGCCANTCTGGTGGGNACATTTTCCCAATTGAGTTTCCCAC
TTCGCACGGGCCACTGGCTTANGTGANGTTC
Sequence Type genomic DNA
Unitrap ID UNI20174

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 35139153..35139503 325
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000007029 (Vars) NM_011690 valyl-tRNA synthetase Gene [Source:MGI Symbol;Acc:MGI:90675]

 
Come back to gene ENSMUSG00000007029


For any suggestions or comments, please send an email to unitrap@crg.es