Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12014A3
Clone ID IST12014A3
Vector VICTR76
Project tigm

Sequence tag IST12014A3HMF1
Sequence
CCATGAGGAAATCTCTCAGGACACACAGAAGAATTACTTGTGTGTGTGTGTCTCAGTATGTGTGTCTGTGTAAGAATGTG
TCATGAANATGTGTGTGTGANAAAGAGTGTGTGTGTGT
Sequence Type genomic DNA
Unitrap ID UNI33807

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 71558282..71558398 113
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000064263 (Gm1631) NP_958754 gene model 1631, (NCBI) Gene [Source:MGI (curated);Acc:Gm1631-001]

 
Come back to gene ENSMUSG00000064263


For any suggestions or comments, please send an email to unitrap@crg.es