Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13412G5
Clone ID IST13412G5
Vector VICTR74
Project tigm

Sequence tag IST13412G5HMF1
Sequence
CTATAAATCCAGTTCCANAGGATCTGTCGAGGTCNATCGACGGTATCGATTANTCCAATTTAGGAAAGATAGGGGCTGGA
GCAATGGCTTANTACATAAGAGCTGCTCGACTAGAGGACATTGTTCCGTTTCTANCACCCATATGGCANCTCACAATCAT
TTGTAACTCCAGTTCCAGGCAACTCAACATCCTCTTCTGACCTCCAGGAGTATCAGGCACACACGTGGTCCACACNCATC
CCTANAN
Sequence Type genomic DNA
Unitrap ID UNI12836

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 7586152..7586333 174
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031163 (Glod5) NM_027227 glyoxalase domain containing 5 Gene [Source:MGI (curated);Acc:Glod5-001]


Sequence tag IST13412G5BBF1
Sequence
ATAGGCACATGCTGCTTGTGTTGTGCTGAGGAATCAAACTCAGGTCTTCATGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 8786726..8786781 56
NO GENE  

 
Come back to gene ENSMUSG00000031163


For any suggestions or comments, please send an email to unitrap@crg.es