Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14681F11
Clone ID IST14681F11
Vector VICTR74
Project tigm

Sequence tag IST14681F11HMF2
Sequence
ATTACCTGGTTATGTTAATTACCTTCCTAGTTGTGACGAAGTGTGTTGGGAGATGGTTTGGGGCACTCTGTATTCANATG
CTAATCTGGCTGCCCAGAGATCAGATTACAGTCTGGACGCCCACCAGTAAAAGTCTGACTCCAGCGTTGTCATGTAATGA
ACCACCTAAAGGTATCTAGGTTGTGTAAAGAATGTTCCCAATTATCNCNGATTGNTTAATACANAGCATCCNAAAGGGGA
NNACNGNGGANNAGAANAGGTNNCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14681F11HMR1
Sequence
GTANTACTTTATAAATGCAAAACACTTTCCTCAAAAATCAGTTTTGGAAAAAGATGCTGATGGAATAGGAGTCCACTACA
ATGGGAAGAATTGGATTATCCTACCCTAGTAGTGAAAAGGCATCGAAGGTAGGAAGGTTGCACACTATCTGTANGATGAC
CGCTATTTTGTTC
Sequence Type genomic DNA
Unitrap ID UNI30172

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 34724890..34725061 168
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028295 (1810030N24Rik) NM_025471 RIKEN cDNA 1810030N24 gene Gene [Source:MGI Symbol;Acc:MGI:1913541]


Sequence tag IST14681F11BBF1
Sequence
ATTACCTGGTTATGTTAATTACCTTCCTAGTTGTGACGAAGTGTGTTGGGAGATGGTTTGGGGCACTCTGTATTCAGATG
CTAATCTGGCTGCCCAGAGATCAGATTACAGTCTGGACGCCCACCAGTAAAAGTCTGACTCCAGCGTTGTCATGTAATGA
ACCACCTAAAGGTATCTAGGTTGTGTAAAGAATGTTCCCAATTATCTCTGATTGGTTAATACANANCATCCNAAAGGGGA
AGACNGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 42210510..42210753 238
NO GENE  

 
Come back to gene ENSMUSG00000028295


For any suggestions or comments, please send an email to unitrap@crg.es