Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13971C9
Clone ID IST13971C9
Vector VICTR74
Project tigm

Sequence tag IST13971C9HMF1
Sequence
CTCCCAAGCAGTGGATTTAGGTCAGCTTCCCAGATGTGCAGGCACAGTGAGTGGGAGGGAGAGTGGTCAGTCGAAN
Sequence Type genomic DNA
Unitrap ID UNI33308

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 29332817..29332891 75
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024008 (Cpne5) NM_153166 copine V Gene [Source:MGI (curated);Acc:Cpne5-001]


Sequence tag IST13971C9BBF1
Sequence
CTCCCAAGCAGTGGATTTAGGTCAGCTTCCCAGATGTGCAGGCACAGTGAGTGGGAGGGAGAGTGGTCAGTCGAAGGCTT
TCCACCTCCAAAGGATCGAATCAACAGACATGCAGCTGATTGGATTATTTGAGAACGTGGCCGTAACCACAAAAATGGTG
AGGCAGCTTGACCCTTGACCCCAAGGCCCAGCCACAGTCAGTGCAGCAACAAAGGCTCCACCTCCCCAGGCTACTGTGAC
CACCACCTGGGTCTGAATGGCTGTCANCACAAAGCCTCCTCAGGGGCCTCCCCTCCCCTCTTCTCTTTAGCAGTGCACCC
TTCCTTGANGGGGTGTAGTTTCAGAGTCCTANATAGAGTGTGTATGTGTGTGTGTGTGTGTGTGTGTGTGTGTGNAN
Sequence Type genomic DNA
Unitrap ID UNI33308

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 29332498..29332891 388
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024008 (Cpne5) NM_153166 copine V Gene [Source:MGI (curated);Acc:Cpne5-001]

 
Come back to gene ENSMUSG00000024008


For any suggestions or comments, please send an email to unitrap@crg.es