Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST466565
Clone ID OST466565
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST466565
Sequence
TCTGAGTCCCTGAAGAGGAAGGAGTAAAGAGTATGAGCATGAGATGGAGCGCCTTGCGCGGGAGAAGATCGCCACCCAGC
AGCGGCTGGCAGAGCTCAAGCATGAGCTGAGTCAGTGGATGGACGTGCTGGAGATAGATCGTGTGCTCCGGCAGACAGGC
CAGCCTGAGGACGACCAGGCGTCCACCTCCACAGCCTCCGAGGGCGAGGACAACGTTGACNAGGAGATGGAGGGNGACCT
GGGCAGGNCTGGGCCCACNTAANCTGAACCATCGTNCNCAGNCGGAGCTGCTGANATCNNCCCTTTGCGTGGGGAAGACA
ANGCACAGCATGTGTTTGATGGAGAGCGGGGGTGCTGTGCTTCGGGGGTGCTGTGTNTCCTGCCTCTNCTTTTGCAGACC
GCTTTGGCTTCTCTTTTTAAGTGGATATTTATTACAAGTGAC
Sequence Type mRNA
Unitrap ID UNI7740

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 74655661..74657853 192
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000000282 (Mnt) NM_010813 minute imprinted gene in the Igf2 region Complex/Cluster/Region [Source:MGI (curated);Acc:Mnt-001]

 
Come back to gene ENSMUSG00000000282


For any suggestions or comments, please send an email to unitrap@crg.es