Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14765B6
Clone ID IST14765B6
Vector VICTR76
Project tigm

Sequence tag IST14765B6HMF1
Sequence
ATTAAGTGCCTCAGAGCCCTGAAATGGCAAGCCATTTTTCAGTGATGGGTTCCTGAGTTGGAGGTCCCAGGAGATGAGAA
AAATAGCAAAAGTAGAAGGTAGAATTTACAACAGCTGCAGTGGGGAGAGCTTACACAAGCTATGTCTTATGCCAAGTAAA
CTTTTTAAGAGTAGCATCTTGTATCCTACTTACAGGAATAAGTGTAAAGAAATGGAGAGCTCTATGAAGTCTGCAGAAAC
TANCATACACTGGGACAAACTCAGAAGTCTAATAAAACAGCACTGTAAAACGGAATTGCCAAGTATCAAAAAAACTATGA
CAGACCAAGGCCCCAGTGGACTTGGGACTGAGAACCATATTGCCACATTGTGGAGAAAGTTGGAATCTCGGGATCTGAAC
ATTGTCTTCCCCAAACGCCCCTAGTCACAGACNATTGCNNCCTCTCCTAATGCTAATCCTGCCTTAAGGGAAAGANCNNT
ATTTTGGACTCAATACACAANGGCNNTAGTCAAGCTCCTAAGCCTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 176866163..176866688 499
 
EST/CDNA Est Name
  CB589696.1 - CX211778.1 - BI248726.1 - CN705698.1 - CN700074.1 - CN698099.1 - CN673436.1 - CN673076.1


Sequence tag IST14765B6BBF1
Sequence
ATTAANTGCCTCAGAGCCCTGAAATGGCAAGCCATTTTTCAGTGATGGGTTCCTGAGTTGGAGGTCCCAGGAGATGAGAA
AAATAGCAAAAGTAGAAGGTAGAATTTACAACAGCTGCAGTGGGGAGAGCTTACACAAGCTATGTCTTATGCCAAGTAAA
CTTTTTAAGAGTAGCATCTTGTATCCTACTTACAGGAATAAGTGTAAAGAAATGGAGAGCTCTATGAAGTCTGCAGAAAC
TAGCATACACTGGGACAAACTCAGAAGTCTAATAAAACAGCACTGTAAAACGGAATTGCCAAGTATCAAAAAAACTATGA
CAGACCAAGGCCCCAGTGGACTTGGGACTGANAANNNTATTGCCNCATTGTGGAGAAAGTTGGAATCTCGGGATCTGAAC
ATTGTCTTCCCCAAACGCCCTANTNNCAGACNATTGCCACCTCTCCTAATGCNNNNCCTGCCTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 176866225..176866688 436
 
EST/CDNA Est Name
  CB589696.1 - CX211778.1 - BI248726.1 - CN705698.1 - CN700074.1 - CN698099.1 - CN673436.1 - CN673076.1


Sequence tag IST14765B6HMR1
Sequence
ATAAATGATTCTGGGGGTCTTTGGTTTGTATATCTCCTAGCTGTCTTAAGTAGGACTTGTAATCTCCAGTCCATATTTAA
ATTGTTCAAAATAACCTGGGGACTGAACTGGAAAGACACTTATGGGTGAGAGCATATGTGGAATCCAAAAAACCTGTTTT
TGGCTGGCTGGTCTTTGANCATTANCCACAGCTGAATCCATGATGCCATTAANAATTTTTACTAATTAATATTTAGTTGT
ATATGCAGTGATTGCTTTCTGGGATGACATGTTAATTCTGGGANAGCTGTCTCTTTTTCCCCTTATAAAGATGTTTCTAA
NACAAGCTATGTN
Sequence Type genomic DNA
Unitrap ID UNI4932

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 176866687..176867018 322
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078872 (OTTMUSG00000016569) predicted gene, OTTMUSG00000016569 Gene [Source:MGI Symbol;Acc:MGI:3650075]

 
Come back to gene ENSMUSG00000078872


For any suggestions or comments, please send an email to unitrap@crg.es