Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13205B10
Clone ID IST13205B10
Vector VICTR74
Project tigm

Sequence tag IST13205B10HMF1
Sequence
ACCAGAAGAGGGACTTCAGGCATAAAGACATCCTCTCCACAGAGAAAACCAAGATGAGGGTGGAACAGAGAATGAACCAG
TCACATAGGCCACACACAAGGCAACACATCTGCCAACAGAATGCCCTCTTGCAGACTTAAATTCAGGAGGGGCTAGAGAG
ATGGCTCAGCAGTTAGGAGCACCGACTGCTCTTCCAGAGGTCCTGAGTTCAATTCCCAGCAACCATGTAGTGGCTCACAG
GCCATCTGTAATAAGATCTGATGCCCTCTTCTGGTGTGTCTGCTACACACAGCTGAAGTGTACCCACATACAATAAATAA
ATAAATAAATAAATAAATANNTCNTNAAAAAAATTCAGGAGGAACTGGGAAGATAACAGANTATGGTGACNACCCTGTCN
NACCNGAAGAGTAGAGCCCCTGCTTCACAGAGGANAGCCNTTTGGAANGTCAGTGCAGANGTCNTCCNNCNGGTGGTGAC
AGCCACACTGN
Sequence Type genomic DNA
Unitrap ID UNI16740

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 71095366..71095855 456
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000003279 (Dlgap1) NM_177639 discs, large (Drosophila) homolog-associated protein 1 Gene [Source:MGI Symbol;Acc:MGI:1346065]


Sequence tag IST13205B10BBF1
Sequence
ACCNNAAGAGGGACTTCAGGCATAAAGACATCCTCTCCACAGAGAAAACCAAGATGAGGGTGGAACAGAGAATGAACCAG
TCACATAGGCCACACACAAGGCAACACATCTGCCAACAGAATGCCCTCTTGCAGACTTAAATTCAGGAGGGGCTAGAGAG
ATGGCTCANCNGTTAGGAGCACCGACTGCTCTTCCAGAGGTCCTGAGTTCAATTCCCAGCNNCCNTGTNNTGGCTCACAG
GCNNNCNGTNATAAGATCNGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000003279


For any suggestions or comments, please send an email to unitrap@crg.es