Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14790B8
Clone ID IST14790B8
Vector VICTR76
Project tigm

Sequence tag IST14790B8HMR1
Sequence
GTCTGTCCTCCCTCCTCTCTCTGGGACCCTCTCACTGGGATTAGACGTTCCACCCTATTCTCCTATTCTCTTCTACCCAG
CTAGTTGGCTTATCCTTTTATTAACCAATCAGAGATGATAGAAAACAATTTTTACATAACACTGAGACCAGAGATGCTTG
ACCTTGCAACCAGATGTCTGGGCATANAAATCANCATCTGAATACACAGTGCACAAAACCATCCCCCAACCTTATGTTAT
GGATTANAATANTTTGTTTCNNAGGAGGGGCTGTTCAGGGAATTGAACCCANAGATTTTGACGTGTAAATTAAAACCTGC
TGAGCTATACACCANCACAGATTAATACTAAATTAAATCTACTCAGTACATANACTCATGCACACACACAACATACNNTA
NAANTAN
Sequence Type genomic DNA
Unitrap ID UNI11446

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 96130712..96131117 380
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032411 (Tfdp2) NM_178667 transcription factor Dp 2 Gene [Source:MGI Symbol;Acc:MGI:107167]


Sequence tag IST14790B8BBF1
Sequence
GCAGATCNGNCNAGGTCGATGNGACGGTATNGNATNANNNNNNATTTANTATGAACTAGGAAGATTCGCTGTGAGGTAGC
AATGAGAAAGCAGTCATAGGAATGTAACAAATTAGAAGTATGTAACAAATTAGAAGTATACAATACAACAATGAACATCA
CTGTGCTGCAAATCAGTTCTTCAGTAATTTGAAAGAATTTTAAGGTTTAAATGTAAAGTTTTAAAACTTTGTAGACTTGG
CTTTAATAAGTTTTTGTTATTATTTTATATGTATGGATATTTTGCCTGTATGTACATCTATGAACCATTTGTGCCTGGTG
CCCACAGAGGCAAGAAGANAGTATGAGAGCCTTTGAAACTGTTGTTACAGACAGTTGTNAAGCTGCCATGTGGGTGCTGG
AAATCACACCCANNNGTTCTAGAAANAGCANCTAGTTCTCNTANCTGCTGAGCCATCNNTNTAGANTCNCAATGGACTAT
TTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 96130239..96130669 399
 
EST/CDNA Est Name
  BB873204.1

 
Come back to gene BB873204.1


For any suggestions or comments, please send an email to unitrap@crg.es