Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10171G9
Clone ID IST10171G9
Vector VICTR76
Project tigm

Sequence tag IST10171G9HMF2
Sequence
ACACAATCTAACTTCTCACTCTGTAAAAGAAAAAAAAATGATTACAATTATCTTTTAGGCTTGCTATATGCCACAGATAA
TGAAAAATAANCAGGAAATTCAACAAGCTAGAACTATTTACTGGCAGGATACAGTGAGAGTCTGGAAAACATCCTACGAC
ACTGANAAAACATTAACAGGTACGCATGTGCTGAAGGCAGTTTATAAATGAAACATTACAAAGCTTGTGATAATGCATCC
AACTAATTAACAGGAGCTGCTATTGGTCCAATAGTAAAGCATCAACTACCACTATATAAGGAGGATTGAAAGCTTCTGTA
CATAAGTTCACTTTGCCTCTCTCACATAGCACGCGCCTTNNNCACTTCTCATTTGTTATCTAACATGCCAATCATAGTTT
TGCANATCTTTACNNGTTTGCACAGGCTACTATAACCACTGTTATTATTTACNAGACANATTTAACCNGTTCCAANANAC
AAATGTTNNTAATCGGTGAAGAAACATTACTACTAACTTTCCCTCNNGGGGANGGAAACCTCANTCTANNNACATGATAC
NNCCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST10171G9BBF1
Sequence
GGACAGTGTGTCTGCGTTCACCTGGCAGTGCTTAGGATTACTATCGGGTGGGGCACTGAGGCAACCGGAGTGACAGCGCG
AGGCTACCGAGCCTTAACTATTTCCATTCCGCGAATGCTGGGAAGGGATCT
Sequence Type genomic DNA
Unitrap ID UNI7740

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 74651578..74651707 130
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000000282 (Mnt) NM_010813 minute imprinted gene in the Igf2 region Complex/Cluster/Region [Source:MGI (curated);Acc:Mnt-001]

 
Come back to gene ENSMUSG00000000282


For any suggestions or comments, please send an email to unitrap@crg.es