Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XR0032
Clone ID XR0032
Vector pGT0lxf
Project sanger

Sequence tag XR0032
Sequence
GATCATCCTGAGGCGGATAATAGAACCTGACCCCGCGGATTGATGTTGACTTTTTTTTTTTTTTTTCTTTTAAGGAGTTT
GCCACGAGCGCGTCCCCTTCATTCTCAGTCCGGGTGTGTTCTCAGCAGGATCGTGGAGAGCGGGTGCTCCTCACCCCTTA
GTCCCTGTGGTCCTGGGCGCACATCTCCTCGCCCCTCTGCTTCTCCGCGGTCCCAGGAAGACGGCTAGCCGGCGAGAGTA
GGAAAGCCACTGAGCCATGGGTGCAGGCAGTTCCACCGAGCAGCGGAGCCCCGAGCAGCCGGCGGAGAGCGACACGCCGA
GCGAGCTGGAGCTCAGTGGCCATGGGCCCGCAGCGGAAGCGTCGGGAGCAGCTGGAGATCCCGCTGACGCGGACCCCGCC
ACCAAG
Sequence Type mRNA
Unitrap ID UNI1668

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 6079873..6080237 357
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038587 (Akap12) NM_031185 A kinase (PRKA) anchor protein (gravin) 12 Gene [Source:MGI Symbol;Acc:MGI:1932576]

 
Come back to gene ENSMUSG00000038587


For any suggestions or comments, please send an email to unitrap@crg.es