Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14072B2
Clone ID IST14072B2
Vector VICTR74
Project tigm

Sequence tag IST14072B2HMF1
Sequence
AGCGGAAATTCATCTTCACCTGCCCCACTGAAAAGGAACAGCGAGAATGGCTAGAGANNCNGCGGGGCGTCTTGTCCAGT
CCCTTGTCACCCCTCCACCTCCTCAGTGAGAAGTGGGGGATGGGTGGGGGTN
Sequence Type genomic DNA
Unitrap ID UNI31031

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 79990672..79990802 125
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020709 (Centa2) NM_172133 ArfGAP with dual PH domains 2 Gene [Source:MGI (curated);Acc:Centa2-001]


Sequence tag IST14072B2BBF1
Sequence
AGCGGAAANNCNNCTTCACCTGCCCCACTGAAAAGGAACAGCGAGAATGGCTAGANAGNCNGCGGGGCGTCTTGTCCAGT
CCCTTGTCACCCCTCCACCTCCTCAGTGAGAAGNGGGGGATGGGTGGGGGTNNNNNNGGGTGANGGCNNAAAAGGGCNCC
TTCACTACAGTCCCAGANGGGCCTGACTCAGCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000020709


For any suggestions or comments, please send an email to unitrap@crg.es