Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10435C8
Clone ID IST10435C8
Vector VICTR76
Project tigm

Sequence tag IST10435C8BBF1
Sequence
CCCCTATAATCTCCTAACCCATTCACCACTTCTTCGACTCCGTTGGATGAGAACCAAATTTTTCCAACTCGTTCTACACT
TGATCATATCANAAAACAAACGTTAAAATGAAGCAGAAGGCTGCACAATGAGGTTCGTTGGATGCGACACTTCTGAGTTA
CCCTAAATTTCCCAAGTCTGGAGAACGTCCGGGAAAGGACTTGGAAACAGCTGCGAAGGATTCGGTCACAGGTATCTCAA
CCNCCTCGGAGGGTGCAAGATGCACGCGCGGGGCAGTTCCTCCTGTTCAGAACACTCAGCCCACAGCTGACTCCCACTTN
CNNACGATAACGCAAGATGGTGGGACCGGCGATTGAAAACCACATTCAAGATGTCNGCTTCCNGTTTTCCCGGCAGCGTC
CCGCGTGGCTGNCGGGGCCACGCCCACTTCCGGTTCCCTTGCTCCGGCATGGCTGCCTTANGGACCTGGCTGTCNAGTGA
GTGANTGNGGGGTTGGGGACACNGNNNCCGCGGGNNNANNNNCCCTNTAACTCCCTGCTNTTCCNTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST10435C8HMF1
Sequence
CCCCTATAATCTCCTAACCCATTCACCACTTCTTCGACTCCGTTGGATGAGAACCAAATTTTTCCAACTCGTTCTACACT
TGATCATATNAGAAAACAAACGTTAAAATGAAGCAGAAGGCTGCACAATGAGGTTCGTTGGATGCGACACTTCTGAGTTA
CCCTAAATTTCCCAAGTCTGGAGAACGTCCGGGAAAGGACTTGGAAACAGCTGCGAAGGATTCGGTCACAGGTATCTCAA
CCACCTCGGAGGGTGCAAGATGCACGCGCGGGGCANTTCCTCCTGTTCANAACACTCNNCCCACAGCTGACTCCCACTTC
CNTACGATAACGCAAGATGGTGGGACCGGCGATTGAAAACCACATTCAAGATGTCGGCTTCCGGTTTTCCCGGCAGCGTC
CCGCGTGGCTGCCGGGGCCACGCCCACTTCCGGTTCCCTTGCTCCGGCATGGCTGCCTTANGGANNTGGCTGTCNNGTGA
GTGATTGTGGGGGTTGGGGACACGNNNNNCGCGGGGCGACCAGCNCTCTAACTCCCTGCTNTTNNATTN
Sequence Type genomic DNA
Unitrap ID UNI32048

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 55045322..55045868 504
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000010406 (Mrpl52) NM_026851 mitochondrial ribosomal protein L52 Gene [Source:MGI Symbol;Acc:MGI:1916086]

 
Come back to gene ENSMUSG00000010406


For any suggestions or comments, please send an email to unitrap@crg.es