Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12723G12
Clone ID IST12723G12
Vector VICTR76
Project tigm

Sequence tag IST12723G12HMF1
Sequence
GCCNTCAGTTATTATTTTATTATTGAGTTATTATTTGTTAACG
Sequence Type genomic DNA
Unitrap ID UNI31419

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 67677478..67677519 40
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024533 (Spire1) NM_176832 spire homolog 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1915416]


Sequence tag IST12723G12BBF1
Sequence
GCCNTCAGTTATTATTTTATTATTGAGTTATTATTTGTTAACATATTTTGAATAATAACCATGTAAGTTGTATGAGCAGC
AAGTTCCNTTCCCN
Sequence Type genomic DNA
Unitrap ID UNI31419

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 67677427..67677519 89
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024533 (Spire1) NM_176832 spire homolog 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1915416]

 
Come back to gene ENSMUSG00000024533


For any suggestions or comments, please send an email to unitrap@crg.es