Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10804H12
Clone ID IST10804H12
Vector VICTR76
Project tigm

Sequence tag IST10804H12HMF1
Sequence
GGTTCATGACCATAATCCCGGCACTCAGGGTTGCTGTGAGTTTCAGGCCANCCTGANCANCNNACAAACAAAAAAGAAAA
AGAAAGGAAATATTTGAGAGGAAGGGATCAAAGGAAGTGAGAGAGAAAACATAANAACGATTCTATTCTTATTTTTATAT
TTAATAAAGAGCTGTGATAAACATCTGTACAATCAATGCACAGAGTTAGGCCTCACTTCCTTGTGGACCAACTATCCATA
CATTAAATATTTGTTTANCATTCCTAGTGTTAGGCACCGTGCCCANCCCTANGAAAGACAGATGGAAAGAGAACTGTCCT
AGGGGAACCGTCCTATCTCGCANGGGGACACANNCAATAGTCCTCTCATGANATAACAATCCAGCCTGGA

Sequence Type genomic DNA
Unitrap ID UNI30557

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 117086582..117086970 363
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028677 (Rnf220) NM_025739 ring finger protein 220 Gene [Source:MGI Symbol;Acc:MGI:1913993]

 
Come back to gene ENSMUSG00000028677


For any suggestions or comments, please send an email to unitrap@crg.es