Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14098D1
Clone ID IST14098D1
Vector VICTR74
Project tigm

Sequence tag IST14098D1BBF1
Sequence
CTANCGGGACAGGCTAGCCACACCCTCACCTGAACTACAATCTGAGTGGCTACTCTTGGCCTACTACTCACCTGGCAATT
CCCGCATCAGGTAGAAGGGGCCACTTCCANCCGTCNACTTATCCNCTCCTGCGGGGGCCGAGGTTGCCNTCNAGGGCNGN
GCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14098D1HMF1
Sequence
NNACCTAGCGGGACAGGCTAGCCACACCCTCACCTGAACTACAATCTGAGTGGCTACTCTTGGCCTACTACTCACCTGGC
AATTCCCGCATCAGGTAGAAGGGGCCACTTCCAGCCGTCC
Sequence Type genomic DNA
Unitrap ID UNI34083

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 84518775..84518891 117
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000050043 (Txndc14) NM_025868 thioredoxin domain containing 14 Gene [Source:MGI (curated);Acc:Txndc14-001]

 
Come back to gene ENSMUSG00000050043


For any suggestions or comments, please send an email to unitrap@crg.es