Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XP0344
Clone ID XP0344
Vector pGT0lxf
Project sanger

Sequence tag XP0344
Sequence
AGGGCGGTGGTGGGTAGTTGGCGGGTGGTTGACTGGAGCAGGCCGCCATGTCCGCAGGGAGCGCGACACATCCTGCCGCT
GGCGGGTAAGGGCTTCGCGGGCCAGGCTGGGGGCAGCGAGCACGGGCCCGGGGCAGGGAGACCGGCGAGGCTGCGTGTGG
GCCGGACGGGCCGTCTAGTAGGACGCGTCCGGATGCCGAGGCCGGGGTTCTGGAGAGAATGTTGAGCTGGCCTCGGGCGC
CCGGAAAGAGGCCGGCCGCGGTGCGAGAGGGAAGGGAGGGAACTCGGAGCCTTTTAGAAGGACGAGCCAAGGAGAAGGCG
AACGCAGAGCGTTCCCGGCCGAGCCGAGTCTCCGGATGGAAGTGACTGGAAAGGAAATGTTTCGTAAGGGGATCGGAATA
AGGGGAGTGGGACTGAGCTTTAGATAGGAATCTCGGGCACGTCTCGGGACCATGGCAGGCGAACATGCAGGCGAT
Sequence Type mRNA
Unitrap ID UNI2992

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 88489725..88490186 462
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028060 (2810403A07Rik) NM_028814 RIKEN cDNA 2810403A07 gene Gene [Source:MGI Symbol;Acc:MGI:1921450]

 
Come back to gene ENSMUSG00000028060


For any suggestions or comments, please send an email to unitrap@crg.es