Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14407F5
Clone ID IST14407F5
Vector VICTR74
Project tigm

Sequence tag IST14407F5HMF1
Sequence
AACTTCCTATCACAGGAAGAGGTGTTCAAAGAGAACCAACGCTTTGGGTAAGGTTTCTGAGCACCAGATGTTCACTTGTT
AGAAATCGGAGCTGTTTGATACACGCTAACTACAACTTTCCTTTTGTAAAACACGACCAGAAAATTCACCTGCCTCCTAT
TTCTACAACTAATAACAGGTTACATAGTTTGAGAATGGCAATATTATCAAATTTCATGGAGTAAGTTAGGAAGAGGAGCT
GAAGTTCAGGCTATAAACTACACTTATTAAACAGTTACGTAGTCTTTCATTTTATCTTACCTTACCTCTACAATGTTCTT
AAGTTCCTTCCATTTATTTATAGAACTCTATTATAATGTCTACCATATACTGNATCTTATACNNNNACTACTTACAATGG
TGTGTTGATAATTTATACAATTAGACACACTNNCACACAAAAATAATTTCCNTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 130312358..130312808 437
 
EST/CDNA Est Name
  BY582794.1 - DT919900.1 - BQ572401.1 - CF725765.1 - CN684028.1 - CA874904.1 - BQ930012.1 - CJ136115.1 - BY744616.1 - CJ135932.1 - BY744946.1 - BY740749.1 - CF899840.1 - CA984629.1 - BG976112.1 - CJ136127.1 - BY738310.1 - DT930900.1 - BY743897.1 - BU923201


Sequence tag IST14407F5BBF1
Sequence
AACTTCCTATCACAGGAAGAGGTGTTCAAAGAGAACCAACGCTTTGGGTAAGGTTTCTGAGCACCAGATGTTCACTTGTT
AGAAATCGGAGCTGTTTGATACACGCTAACTACAACTTTCCTTTTGTAAAACACGACCAGAAAATTCACCTGCCTCCTAT
TTCTACAACTAATAACAGGTTACATAGTTTGAGAATGGCAATATTATCAAATTTCATGGAGTAAGTTAGGAAGAGGAGCT
GAAGTTCAGGCTATAAACTACACTTATTAAACAGTTACGTAGTCTTTCATTTTATCTTACCTTACCTCTACAATGTTCTT
AAGTTCCTTCCATTTATTTATAGAACTCTATTATAATGTCTACCATATACTGTATCTTATACCTATACTACTTACNATGG
TGTGTTGATAATTTATACAATTAGACACACTAACNCACAAAAATAATTTCCTTAAATTTTTTTTTAACNNNNTAGTTTTG
AAAGANGTCTGAAACAGTTTCNGNTCTNCNNCNTTCTCTNGTTGAANTTGNTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 130312358..130312887 500
 
EST/CDNA Est Name
  BY582794.1 - DT919900.1 - CX237866.1 - BI691936.1 - BI150682.1 - BI648119.1 - BI854692.1 - BQ572401.1 - CF725765.1 - BU706260.1 - BQ891100.1 - BI099659.1 - CF723716.1 - CF731235.1 - CN684028.1 - BY734284.1 - CX237460.1 - CJ136212.1 - BY733398.1 - CA874904


Sequence tag IST14407F5HMR1
Sequence
AGTTAATAAAACTGTAGGACTTCATCTTACTCCCTTCACAGGGCAAATTTATATCTCTTCTTTGAAGTAGATTAATCTCC
CTTGGAATAAGGTAGTTAAGAAGCATTCTATGCATGTGTAAGTTATACCTGGGAGTACTATTATGCATGATATATCTATG
CACATATGTAAATATAATAAATATATAACCNGAAACTGGGTGCTTTTTTTCTTTGTAGTAAGCACATACATAAGTGAACA
AATTTCCATATTTAAAATGGCTGAGTTTAAAAGTGTACTTTTGGAAATTAATACNAATTTNTTTGTAGTTCTAGGTACTT
GNNNTNATGTATTN
Sequence Type genomic DNA
Unitrap ID UNI938

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 130312029..130312361 319
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026356 (Dars) NM_145507 aspartyl-tRNA synthetase Gene [Source:MGI Symbol;Acc:MGI:2442544]

 
Come back to gene ENSMUSG00000026356


For any suggestions or comments, please send an email to unitrap@crg.es